View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10966_high_4 (Length: 240)

Name: NF10966_high_4
Description: NF10966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10966_high_4
NF10966_high_4
[»] chr2 (1 HSPs)
chr2 (51-224)||(1111585-1111758)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 51 - 224
Target Start/End: Complemental strand, 1111758 - 1111585
Alignment:
51 aggttgataaatagcgacttcatcttgaggggtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatc 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1111758 aggttgataaatagcgacttcatcttgaggggtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatc 1111659  T
151 cgttcaccatcttttggttgcttctgcttcacttgttgttgatcttcactcgtcgacatcactctttctctgct 224  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
1111658 cgttcaccatcttttggttgcttctgcttcacttgtcgttgatcttcactcgtcgacatcactctttctctgct 1111585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University