View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10966_low_8 (Length: 240)
Name: NF10966_low_8
Description: NF10966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10966_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 51 - 224
Target Start/End: Complemental strand, 1111758 - 1111585
Alignment:
| Q |
51 |
aggttgataaatagcgacttcatcttgaggggtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111758 |
aggttgataaatagcgacttcatcttgaggggtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatc |
1111659 |
T |
 |
| Q |
151 |
cgttcaccatcttttggttgcttctgcttcacttgttgttgatcttcactcgtcgacatcactctttctctgct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111658 |
cgttcaccatcttttggttgcttctgcttcacttgtcgttgatcttcactcgtcgacatcactctttctctgct |
1111585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University