View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10967_high_4 (Length: 338)
Name: NF10967_high_4
Description: NF10967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10967_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 38042580 - 38042256
Alignment:
| Q |
1 |
atagttgaatcaaccccatcctcattctcctcttcctcatcattgttggtttccactgtgccagcaccggcaaatgattctaacaaaaagaagacagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042580 |
atagttgaatcaaccccatcctcattctcctcttcctcatcattgttggtttccactgtgccagcaccggcaaatgattctaacaaaaagaagacagttt |
38042481 |
T |
 |
| Q |
101 |
tcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042480 |
tcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaa |
38042381 |
T |
 |
| Q |
201 |
ggacgtgaagtccaattgggaaaccttacacgagcttcttcttagctatctcgctattaatcccaacaacactcacaagtttattctcgatgctttttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042380 |
ggacgtgaagtccaattgggaaaccttacacgagcttcttcttagctatctcgctattaatcccaacaacactcacaagtttattctcgatgctttttct |
38042281 |
T |
 |
| Q |
301 |
gatcttattgttactcttatgtcct |
325 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
38042280 |
gatcttattgttactctcatgtcct |
38042256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 100 - 198
Target Start/End: Original strand, 31980765 - 31980863
Alignment:
| Q |
100 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatg |
198 |
Q |
| |
|
||||| ||||||||||| || ||||| || || || || ||||| ||||||||| |||| || ||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
31980765 |
ttcaatggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgcaagagatggtggaggcgcgaccggagttgatg |
31980863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University