View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10967_high_7 (Length: 239)
Name: NF10967_high_7
Description: NF10967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10967_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1573720 - 1573943
Alignment:
| Q |
1 |
ttgcttcaatggccagtagaagaagtagaaagcttaagactgagtagtgatgaatatgcagaagtagttgttacacctggctctattgttccattgaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1573720 |
ttgcttcaatggccagtagaagaagtagaaagcttaagactgagtagtgatgaatatgcagaagtagttgttacacctggctctgttgttccattgaaca |
1573819 |
T |
|
| Q |
101 |
ttactcaagcaacacaggttttgtctatagcattttctaagttatcatattacttgannnnnnnnnnnnnnnnnnnaaggttatttctaaaaccaataaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1573820 |
ttactcaagcaacacaggttttgtctatagcattttctaagttatcatattacttgattttttgcttttttgttttaaggttatttctaaaaccaataaa |
1573919 |
T |
|
| Q |
201 |
tttcttatttgtgataaaattatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1573920 |
tttcttatttgtgataaaattatt |
1573943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University