View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1096_low_17 (Length: 292)
Name: NF1096_low_17
Description: NF1096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1096_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 60 - 240
Target Start/End: Complemental strand, 37438538 - 37438358
Alignment:
| Q |
60 |
cagataactattgcaacggccgtattattttgtcagcgattctttcttcgacaatctcatgcaaagaacgaccatagggtaggttgtagcgctttcaaat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37438538 |
cagataactattgcaacggccgtattattttgtcagcgattctttcttcgacaatctcatgcaaagaacgaccatagggtaggttgtagcgctttcaaat |
37438439 |
T |
|
| Q |
160 |
tgatattatgtaggcattttacctctcaaacagtttagtaagttccattttaatttagtgttgtgtggcacgtctctgctc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37438438 |
tgatattatgtaggcattttacctctcaaacagtttagtaagttccattttaatttagtgttgtgtggcacgtctgtgctc |
37438358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 32503372 - 32503492
Alignment:
| Q |
64 |
taactattgcaacggccgtattattttgtcagcgattctttcttcgacaatctcatgcaaagaacgaccatagggtaggttgtagcgctttcaaattgat |
163 |
Q |
| |
|
||||||| ||||| ||| || |||||||||| |||||||||||||||||||||||||||||||| |||| ||||| |||||| ||||| |||| ||| |
|
|
| T |
32503372 |
taactatagcaacagccataatattttgtcatcgattctttcttcgacaatctcatgcaaagaatgaccgaagggtgggttgttatgcttttaaatagat |
32503471 |
T |
|
| Q |
164 |
attatgtaggcattttacctc |
184 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
32503472 |
attttgtaggcattttacctc |
32503492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University