View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1096_low_23 (Length: 202)
Name: NF1096_low_23
Description: NF1096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1096_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 26 - 187
Target Start/End: Complemental strand, 12354816 - 12354654
Alignment:
| Q |
26 |
tataacgactgctccccaatagtgatcaatagcatcagtttgttaaattctttttccatctcctggaatttttagggcaggtggagtttgagaaaacttt |
125 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| || |||| |
|
|
| T |
12354816 |
tataaggactgctccccaatagtgatcactagcatcagtttgtagaattctttttccatctcctggaatttttggggcaggtggagtttgagcaaccttt |
12354717 |
T |
|
| Q |
126 |
ttcaagattttaactgcttcagtttgttttattccccat-gtggaggatttttcttgagcaac |
187 |
Q |
| |
|
||||||||||||| |||||| |||| |||| |||| || ||||||||||||||||||||||| |
|
|
| T |
12354716 |
ttcaagattttaattgcttcggtttattttgttccagatggtggaggatttttcttgagcaac |
12354654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University