View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_high_23 (Length: 275)
Name: NF10970_high_23
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 100 - 270
Target Start/End: Original strand, 11196941 - 11197111
Alignment:
| Q |
100 |
agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11196941 |
agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat |
11197040 |
T |
 |
| Q |
200 |
acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgcttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11197041 |
acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgcttct |
11197111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 61
Target Start/End: Original strand, 11196864 - 11196902
Alignment:
| Q |
23 |
atgattcgacgtcgttaccgttcaagaaagcctgtggaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11196864 |
atgattcgacgtcgttaccgttcaagaaagcctgtggaa |
11196902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University