View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_10 (Length: 388)
Name: NF10970_low_10
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 380
Target Start/End: Complemental strand, 33009200 - 33008838
Alignment:
| Q |
18 |
atttctatacgattaatttacgggtaccggcactagtatatacaannnnnnnngtcatcctataacatatgttgataatctcacatcaaattttaggaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33009200 |
atttctatacgattaatttacgggtaccggcactagtatatacaattttttttgtcatcctatagtatatgttgataatctcacatcaaattttaggaca |
33009101 |
T |
|
| Q |
118 |
agaaaaaagagaagagagtttacctttttaattttaggtcttgaatttgattgaacaatgggcaatggaaccttcttttcagatgatgattttctaagag |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33009100 |
agaaaaaagacaagagagtttacctttttaattttaggtcttgaatttgattgaacaatgggcaatggaaccttcttttcagatgctgattttctaagag |
33009001 |
T |
|
| Q |
218 |
atcgagaatgagcaagaagcaaagcacgacgatcatgttcatatccctgcgtttctgcatttgtaagattttcacgtggctttgttttcttcatggaacg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33009000 |
atcgagaatgagcaagaagcaaagcacgacgatcatgttcatatccctgcgtttctgcatttataagattttcacgtggctttgttttcttcatggaacg |
33008901 |
T |
|
| Q |
318 |
agttttaggagattccacgtacactttgataattaccccattggtgttggtgtttttcttctc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33008900 |
agttttaggagattccacgtacactttgataattaccccattggtgtgcgtgtttttcttctc |
33008838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University