View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_11 (Length: 371)
Name: NF10970_low_11
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 150 - 354
Target Start/End: Complemental strand, 40992221 - 40992003
Alignment:
| Q |
150 |
caataagagatctaattcccaactaaaatggttaagaaattaagatatctcagttgt--------------tttggcaaattttcannnnnnnnaaacat |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
40992221 |
caataagagatcgaattcccaactaaaatggttaagaaattaagatatctcagttgtcaaaatataataggtttggcaaatttttattttttttaaacat |
40992122 |
T |
 |
| Q |
236 |
gtgaccaagtcaatccttgaccatgtagagtgtggcttgaatattttgcctcttcgtcacgtaactcatcccatccagatgtcgcctcaattgaattttc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40992121 |
gtgaccaagtcaatccttgaccatgtagagtgtggcttgaatattttgcctctttgtcacgtaactcatcccatccagatgtcgcctcaattgaattttc |
40992022 |
T |
 |
| Q |
336 |
ctattatttatatttccac |
354 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
40992021 |
ctattatttacatttccac |
40992003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University