View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_12 (Length: 370)
Name: NF10970_low_12
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_12 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 18 - 359
Target Start/End: Complemental strand, 43102538 - 43102197
Alignment:
| Q |
18 |
acttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagttccagctgcctctgcagcctccaacctcttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43102538 |
acttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagtcccagctgcctctgcagcctccaacctcttc |
43102439 |
T |
|
| Q |
118 |
attgtgttgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcaccggctggaagcctttac |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43102438 |
attgtattgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcaccggctggaagcctttac |
43102339 |
T |
|
| Q |
218 |
tccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgtaac |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43102338 |
tccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgttac |
43102239 |
T |
|
| Q |
318 |
cattgcttctatcgggattctaattcaaactacttcattcat |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102238 |
cattgcttctatcgggattctaattcaaactacttcattcat |
43102197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 273
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
232 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
273 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 293
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
241 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
293 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University