View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_27 (Length: 265)
Name: NF10970_low_27
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 94 - 247
Target Start/End: Complemental strand, 48449798 - 48449641
Alignment:
| Q |
94 |
cgtcgcagaatttcagatttggcccattgaatctccttctctggctttaatttttctattctgcaaaatcatcacaatcatacaatagaaacaaattatc |
193 |
Q |
| |
|
|||||||||||||| || ||||||| |||||||||||||||||||||||||||||| || ||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48449798 |
cgtcgcagaatttcggacttggcccgttgaatctccttctctggctttaatttttccatactgaaaaattttcacaatcatacaatagaaacaaattatc |
48449699 |
T |
 |
| Q |
194 |
cacctc----aaaaacaaatacaagtgaaacaacctttggagttgtcaatgataaaat |
247 |
Q |
| |
|
|||| | ||||| ||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
48449698 |
caccacaaaaaaaaaaaaatacaagtgaaacaagctttgaagtagtcaatgataaaat |
48449641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 29 - 178
Target Start/End: Complemental strand, 34227292 - 34227152
Alignment:
| Q |
29 |
aaactagtgtcattgtctgcatagctgatgtgaaaaata-----ctaatccggataccagaaactaattacgtcgcagaatttcagatttggcccattga |
123 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| | |||||||||||||||||||||||||| ||| ||||||||| || |
|
|
| T |
34227292 |
aaactagtgtcgttgtctgcatagttgatgtgaaaaaaaaaaaactaatccggataccagaaactaattatgtctcagaatttc--------------ga |
34227207 |
T |
 |
| Q |
124 |
atctccttctctggctttaatttttctattctgcaaaatcatcacaatcatacaa |
178 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||||| ||||||||||||||| |
|
|
| T |
34227206 |
atctccttctctggctttaatattttcatgctgcaaaattatcacaatcatacaa |
34227152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 34227157 - 34227117
Alignment:
| Q |
208 |
atacaagtgaaacaacctttggagttgtcaatgataaaatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34227157 |
atacaagtaaaacaacctttggagttgtcaatgataaaatg |
34227117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University