View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_34 (Length: 238)
Name: NF10970_low_34
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 38100831 - 38100715
Alignment:
| Q |
108 |
tcatgcttatagccaattttacaaccaaattgaaggggatttgaactctatcccttaaaattacattatcaaaatcttactactgagttgacatctaatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38100831 |
tcatgcttatagccaattttacaaccaaattgaaggggatttgaactctatcccttaaaattacattatcaaaatcttactactgagttgacatctaatg |
38100732 |
T |
 |
| Q |
208 |
gttaaacaagtacttat |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38100731 |
gttaaacaagtacttat |
38100715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 38100933 - 38100850
Alignment:
| Q |
1 |
agttcttatcgtataacaacgctatgaatgaacttattaaacaagtacttataaaaataaatcgaggaaggagaaaattattac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38100933 |
agttcttatcgtataacaacgctatgaatgaactttttaaacaagtacttataaaaataaatcgaggaaggagaaaattattac |
38100850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University