View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10970_low_37 (Length: 230)
Name: NF10970_low_37
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10970_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 23 - 218
Target Start/End: Original strand, 32062383 - 32062578
Alignment:
| Q |
23 |
gtctctatcaaatgagtcatgctcacacggactgagattcatactttatcatgttaatgaatttttggaattcacatgcattcacagnnnnnnnnnnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062383 |
gtctctatcaaatgagtcatgctcacgcggactgaaattcatactttgtcatgttaatgaatttttggaattcacatgcattcacataaaagaaaagaaa |
32062482 |
T |
 |
| Q |
123 |
nnntagtattaggtgtatgttttgcttgagggttgttcttgtagttgatggtatatgtataatatgtgagatatgtttttggttaaagcacaggtt |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32062483 |
aaatagtatgaggtgtatgttttgcttgagggttgttcttgtagttgatggtatatgtataatatgtgagatatgtttttggttaaagcactggtt |
32062578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University