View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10971_low_2 (Length: 396)
Name: NF10971_low_2
Description: NF10971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10971_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 16 - 377
Target Start/End: Original strand, 44553086 - 44553448
Alignment:
| Q |
16 |
atgaatgcttcagcaagtccggccaatgccagctgaggaatcagccacagacctgacattgatgaaattgcaccttttcttgattccacttctaagggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553086 |
atgaatgcttcagcaagtccggccaatgccagctgaggaatcagccacagacctgacattgatgaaattgcaccttttcttgattccacttctaagggtt |
44553185 |
T |
|
| Q |
116 |
tagtaagagccagagttctgcgacgatcttcaactatggcagatactagcatgctgagtatacccaaaa-aatgccaatgcccatcctctgaaggagtgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44553186 |
tagtaagagccagagttctgcgacgatcttcaactatggcagatactagcatgctgagtatacccaaaaaaatgccaatgcccatcctctgaaggagtgt |
44553285 |
T |
|
| Q |
215 |
gatgccaccctcttttcgagtgatcctttggagtaaaggaacaacttttcggtcgtaaatgggcaaccaaattgccacactgatcatcagaaagacatag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553286 |
gatgccaccctcttttcgagtgatcctttggagtaaaggaacaacttttcggtcgtaaatgggcaaccaaattgccacactgatcatcagaaagacatag |
44553385 |
T |
|
| Q |
315 |
taggatgctcctgggatcatgaacttgctttgcccaatacgcctgtcagataaaagcgcttgg |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553386 |
taggatgctcctgggatcatgaacttgctttgcccaatacgcctgtcagataaaagcgcttgg |
44553448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University