View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10972_high_4 (Length: 309)
Name: NF10972_high_4
Description: NF10972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10972_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 2494109 - 2494391
Alignment:
| Q |
19 |
gaatcactcaccttcgcggagatcttgattcaggttctaatctaaactttcacatacctttcttattttgcaatttggtttcgagctcgtacacgggctc |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494109 |
gaatcactcaccttcgtggagatcttgattcaggttctaatctaaactttcacatacctttcttattttgcaatttggtttcgagctcgtacacgggctc |
2494208 |
T |
|
| Q |
119 |
gctggattgtgcattggtgcgtggatttttattctggattctgatgtgaggttactatactataccctttagggttgtttgttatgttctttatttttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494209 |
gctggattgtgcattggtgcgtggatttttattctggattctgatgtgaggttactatactataccctttagggttgtttgttatgttctttatttttca |
2494308 |
T |
|
| Q |
219 |
ttttaagcatctcgtctggttttattttgtttctactgggtaaggcttttatgtcacccgaatctttgtataatgttcttctc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||| ||||||||||| |
|
|
| T |
2494309 |
ttttaagcatctcgtctggttttattttgtttctactgggtaaggcttttatgtcactccagtctttgtactatgttcttctc |
2494391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University