View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10974_low_5 (Length: 238)
Name: NF10974_low_5
Description: NF10974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10974_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 18248973 - 18249097
Alignment:
| Q |
1 |
atcactatcaaactcttgtgaacgatcaccaa-gctattattattgcttgccttattaaatctgctgaacgaatgcaacgttctttgtatctcatgatct |
99 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||| | |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18248973 |
atcactatcaaactcttgggaatgatcgccaaagttattattattgcttgccttattaagtctactgaacgaatgcaacgttctttgtatctcataatct |
18249072 |
T |
|
| Q |
100 |
aaagaatataaaactttagactttg |
124 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18249073 |
aaagaatataaaactttagactttg |
18249097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University