View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10975_high_4 (Length: 250)

Name: NF10975_high_4
Description: NF10975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10975_high_4
NF10975_high_4
[»] chr2 (2 HSPs)
chr2 (1-245)||(13960313-13960557)
chr2 (48-231)||(13967491-13967674)
[»] chr4 (2 HSPs)
chr4 (35-232)||(49870992-49871189)
chr4 (115-229)||(49865135-49865249)
[»] scaffold0618 (1 HSPs)
scaffold0618 (96-136)||(6835-6875)
[»] chr8 (3 HSPs)
chr8 (96-136)||(44067730-44067770)
chr8 (96-136)||(44087534-44087574)
chr8 (96-136)||(44093036-44093076)


Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 13960557 - 13960313
Alignment:
1 catcggcagctacgaaacattgttgttcttctaatggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960557 catcggcagctacgaaacattgttgttcttctaatggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgat 13960458  T
101 tgtgccagagatgctgcagtcacggtagaattgacgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960457 tgtgccagagatgctgcagtcacggtagaattgacgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttg 13960358  T
201 tctgctgttactcggagtgcaactgcttgatgtttctctgctcct 245  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
13960357 tctgctgttactcggagtgcaactgcttgatgtttctctggtcct 13960313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 48 - 231
Target Start/End: Complemental strand, 13967674 - 13967491
Alignment:
48 attagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgacgttgggattcgg 147  Q
    ||||||||||| |||||||||||| |||||||||| ||  | |  | |||||||||||||||||||  ||||||||||||||||||||||||||||| |     
13967674 attagtttgcaattttggaaaactccaaaggcgtcgccaaaaacaaagtcgattgtgccagagatggcgcagtcacggtagaattgacgttgggattgga 13967575  T
148 cgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgat 231  Q
    || |||||||  ||||| |||| || ||||| ||||||| ||| |||||||  ||||||||||||||||| |||||||||||||    
13967574 cgtagagtgtgtcttggaaaccgtccatttgacagttgtggaatattgcttgatctgctgttactcggagggcaactgcttgat 13967491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 232
Target Start/End: Original strand, 49870992 - 49871189
Alignment:
35 tggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattga 134  Q
    ||||||||| ||||| ||||||||||||||||||||| |||  || |||||  |||  | ||||||||| || |  ||| ||||||| |||||||||||     
49870992 tggttttctaacgatgagtttgcagttttggaaaactccaactgcatcaccaaagacaaagtcgattgttccggtaatggtgcagtcgcggtagaattgt 49871091  T
135 cgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgatg 232  Q
    | || |||||  | | |||||||  |||||||||| |  ||||  ||||||||||| | |||||||||||||||||| ||||| || |||||||||||    
49871092 cttttggattgtgtgtagagtgtatcttggtaaccgttcatttcacagttgtagaacaatgctttgtctgctgttacacggagggccactgcttgatg 49871189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 229
Target Start/End: Original strand, 49865135 - 49865249
Alignment:
115 tgcagtcacggtagaattgacgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcg 214  Q
    ||||||| ||||||||||| | || |||||  | | |||||||  |||||||||| || ||||| ||||||||||| | |||||||||||||||||| ||    
49865135 tgcagtcgcggtagaattgtcttttggattgtgtgtagagtgtatcttggtaaccgtccatttgacagttgtagaacaatgctttgtctgctgttacacg 49865234  T
215 gagtgcaactgcttg 229  Q
    ||| || ||||||||    
49865235 gagggccactgcttg 49865249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 6875 - 6835
Alignment:
96 tcgattgtgccagagatgctgcagtcacggtagaattgacg 136  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
6875 tcgattgttccatagatgttgcagtcacggtagaattgacg 6835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 44067730 - 44067770
Alignment:
96 tcgattgtgccagagatgctgcagtcacggtagaattgacg 136  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44067730 tcgattgttccatagatgttgcagtcacggtagaattgacg 44067770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 44087574 - 44087534
Alignment:
96 tcgattgtgccagagatgctgcagtcacggtagaattgacg 136  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44087574 tcgattgttccatagatgttgcagtcacggtagaattgacg 44087534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 44093036 - 44093076
Alignment:
96 tcgattgtgccagagatgctgcagtcacggtagaattgacg 136  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44093036 tcgattgttccatagatgttgcagtcacggtagaattgacg 44093076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University