View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10975_low_3 (Length: 356)
Name: NF10975_low_3
Description: NF10975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10975_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 329
Target Start/End: Original strand, 47493758 - 47494067
Alignment:
| Q |
17 |
caacatcatcctgacgaactcttgataatcaacgagaccgtcaccatccagatcagccgttttgatcatctgttccagttcttcgtctgtcaccttttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47493758 |
caacatcatcctgacgaactcttgataatcaacgaggccgtcaccatccagatcagccgttttgatcatctgctccagttcttcgtctgtcaccttttct |
47493857 |
T |
|
| Q |
117 |
ccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttcaatattacggtacgacaaaacaaattatatatgttgaatta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47493858 |
ccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttc---attacggtacaacaaaacaaattatatatgttgaatta |
47493954 |
T |
|
| Q |
217 |
attatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaaattcctcttctgcttcactttcctttttcgtaca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47493955 |
attatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaaattcctcttccgcttcactttcctttttcgtaca |
47494054 |
T |
|
| Q |
317 |
taaaaattcacaa |
329 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
47494055 |
tacaaattcacaa |
47494067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University