View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10976_low_17 (Length: 250)
Name: NF10976_low_17
Description: NF10976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10976_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 25295620 - 25295867
Alignment:
| Q |
1 |
caccccattatatcaatcaaccaggtttaactcaaattaataatcttatattgtggactcgtaccctctacagtgccaaaagaggaagaatcaatannnn |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25295620 |
caccccattatatcaatccaccaggtttaactcaaattaataatct-atattgtggac----accctctacagtgccaaaagaggaagaatcaatatttt |
25295714 |
T |
 |
| Q |
101 |
nnnn--ggtgaaaagaagcattaatcata----atcctaatcatatgagtgaaca---ttttaatcattgctcattaaatcatacagaaatctcaagaat |
191 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25295715 |
ttttttggtgaaaagaagcattaatcatatataatcctaatcatatgagtgaacaatattttaatcattgctaattaaatcatacagaaatctcaagaat |
25295814 |
T |
 |
| Q |
192 |
aacaacgtgataacatccctacaaaaatacaccaatccatctattcttctcac |
244 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25295815 |
aacaacttgataacatccctacaaaaatacaccaatccatctattcttttcac |
25295867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University