View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10976_low_21 (Length: 240)
Name: NF10976_low_21
Description: NF10976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10976_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 51 - 224
Target Start/End: Complemental strand, 25295578 - 25295392
Alignment:
| Q |
51 |
aaatcgtataatatatgtggtttcata-gattattaaggtttcattgaaccttattttttcccttccataattgttgtgatgatgtgagtttttggaatg |
149 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25295578 |
aaatcgtataatatatgtggtttcataagattattaaggtttcattgaacctaattttttcccttccataattgttctgatgatgtgagtttttggaatg |
25295479 |
T |
 |
| Q |
150 |
tcaacgtgtcactgcaccaaagtgactat------------aataatgatatttcctttcctcaataagttaccgatacaaagttat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25295478 |
tcaacgtgtcactgcaccaaagtgactatagaaatggcatgaagaatgatatttcctttcctcaataagttaccgatacaaagttat |
25295392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University