View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10977_low_19 (Length: 372)
Name: NF10977_low_19
Description: NF10977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10977_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 22 - 357
Target Start/End: Original strand, 10747939 - 10748274
Alignment:
| Q |
22 |
actttacaagtgctattaaatacttgagaatgatgtttcttattgtaagtcttcttaagaaccactatacattctactcggtgatggaacttaggcttta |
121 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10747939 |
actttacaagtgctattaaatgcttgggaatgatgtttcttattgtaagtcttcttaagaaccactatacattctactcggtgatggaacttaggcttta |
10748038 |
T |
|
| Q |
122 |
caagtgctggcacaacttcaaaacttgaactcaaggttacttgtatcaatattggtaatcctcttccagaatctagcatatcctccatgcttcttccagc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10748039 |
caagtgctggcacaacttcaaaacttgaactcaaggttacttgtatcaatattggtaatcctcttccagaatctagcatatcctccatgcttcttccagc |
10748138 |
T |
|
| Q |
222 |
accatacatgggcttattctttgcctctaattgcaatggaaagattgttaatccactttctgcgtatagctcaggtccctacatatatgcaaacattgtn |
321 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10748139 |
accatacatgggcttattctttacctctaattgcaatggaaagactgttaatccactttctgcgtatagctcaggtccctacatatatgcaaacattgta |
10748238 |
T |
|
| Q |
322 |
nnnnnncatgctgatgagatgagatgataccctctc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10748239 |
aaaaaacatgctgatgagatgagatgataccctctc |
10748274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University