View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10977_low_25 (Length: 322)
Name: NF10977_low_25
Description: NF10977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10977_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 303
Target Start/End: Original strand, 35825198 - 35825500
Alignment:
| Q |
15 |
gaggatgaaattacaaattgaagcttttagtttttacggtgaaaactacattagaacgcgaaaatagaccggccaccg--------------tgcttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
35825198 |
gaggatgaaattacaaattgaagcttttagtttttacgatgaaaactacattagaacgcaaaaatagaccggccaccgcggctgcaaacacatgcttagt |
35825297 |
T |
 |
| Q |
101 |
tgatagattacttttggaataggtccccagaaatttgtgtccccagactcactaaacttgaacaccaagagccttacggtaggggccaacccggcaaaca |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35825298 |
tgatagattacttttagaataggtccccagaaatttgtgtcccctgactcactaaacttgaacaccaagagccttacggtaggggccaacccggcaaaca |
35825397 |
T |
 |
| Q |
201 |
ctctctaaaaccaaaattaaattcatactgttttcaaaatctgacaacagtgacttcagcttaagtacatagtcatcttcatgggacctcaaaccctcca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35825398 |
ctctctaaaaccaaaattaaattcatactgttttcaaaatctgacaacagtgacttcagcttaagtacatagtcatcttcatgggacctcaaaccctcca |
35825497 |
T |
 |
| Q |
301 |
ggt |
303 |
Q |
| |
|
||| |
|
|
| T |
35825498 |
ggt |
35825500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 42544396 - 42544344
Alignment:
| Q |
26 |
tacaaattgaagcttttagtttttacggtgaaaactacattagaacgcgaaaa |
78 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| |||| ||||| ||||| |
|
|
| T |
42544396 |
tacaaattgaagcttctagttttcacggtgaaaactgcattggaacgtgaaaa |
42544344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University