View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10977_low_25 (Length: 322)

Name: NF10977_low_25
Description: NF10977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10977_low_25
NF10977_low_25
[»] chr7 (1 HSPs)
chr7 (15-303)||(35825198-35825500)
[»] chr8 (1 HSPs)
chr8 (26-78)||(42544344-42544396)


Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 303
Target Start/End: Original strand, 35825198 - 35825500
Alignment:
15 gaggatgaaattacaaattgaagcttttagtttttacggtgaaaactacattagaacgcgaaaatagaccggccaccg--------------tgcttagt 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||              ||||||||    
35825198 gaggatgaaattacaaattgaagcttttagtttttacgatgaaaactacattagaacgcaaaaatagaccggccaccgcggctgcaaacacatgcttagt 35825297  T
101 tgatagattacttttggaataggtccccagaaatttgtgtccccagactcactaaacttgaacaccaagagccttacggtaggggccaacccggcaaaca 200  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35825298 tgatagattacttttagaataggtccccagaaatttgtgtcccctgactcactaaacttgaacaccaagagccttacggtaggggccaacccggcaaaca 35825397  T
201 ctctctaaaaccaaaattaaattcatactgttttcaaaatctgacaacagtgacttcagcttaagtacatagtcatcttcatgggacctcaaaccctcca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35825398 ctctctaaaaccaaaattaaattcatactgttttcaaaatctgacaacagtgacttcagcttaagtacatagtcatcttcatgggacctcaaaccctcca 35825497  T
301 ggt 303  Q
    |||    
35825498 ggt 35825500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 42544396 - 42544344
Alignment:
26 tacaaattgaagcttttagtttttacggtgaaaactacattagaacgcgaaaa 78  Q
    ||||||||||||||| ||||||| |||||||||||| |||| ||||| |||||    
42544396 tacaaattgaagcttctagttttcacggtgaaaactgcattggaacgtgaaaa 42544344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University