View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10977_low_28 (Length: 294)
Name: NF10977_low_28
Description: NF10977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10977_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 129 - 278
Target Start/End: Original strand, 43235091 - 43235240
Alignment:
| Q |
129 |
tttaccttctagcaccaaccattctggcattttccctcatattgacttacatacttctatcacacgggccaatcaacacatttttgtcttatagttcaaa |
228 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43235091 |
tttagcttctagcaccaaccattctggcattttccctcatattgacttacatacttctatcacacgggccaatcaacacatttttgtcttatagttcaaa |
43235190 |
T |
 |
| Q |
229 |
ataacataaatgacatcgattcaattatgaagagttagaaatgaatgaat |
278 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43235191 |
ataacacaaatgacatcgattcaattatgaagagttagaaatgaaagaat |
43235240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 43234963 - 43235042
Alignment:
| Q |
1 |
aatatcccatgcttatttccttgacatccaaaactgtaggagggaattaagaatgggttaattaatattcaagtagaatt |
80 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43234963 |
aatatcccatggttatttccttgacatccaaaactgtaggagggaattaagaatgggttaattaatattcaagtagaatt |
43235042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University