View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10977_low_41 (Length: 217)
Name: NF10977_low_41
Description: NF10977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10977_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 243877 - 243942
Alignment:
| Q |
18 |
atgccaagaagcaaagtcatgtttaatttggtttatgatagaggttgacaaaaacattccctctta |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243877 |
atgccaagaagcaaagtcatgtttaatttggtttatgatagaggttgacaaaaacattccctctta |
243942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 52799147 - 52799193
Alignment:
| Q |
159 |
catctagacctacacgacacaatcgccatgtttatcaatccacaaag |
205 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
52799147 |
catctagaccaacacgacacaatcaccatgtttagcaatccacaaag |
52799193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University