View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10979_high_9 (Length: 328)
Name: NF10979_high_9
Description: NF10979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10979_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 8794476 - 8794774
Alignment:
| Q |
1 |
cacaacttgtgagtgatgtggtgaacataatccaagacgcttaaagtattgtttgtcaaattttacaacaattaaaaaatatagaggctgctttatttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8794476 |
cacaacttgtgagtgatgtggtgaacataatccaagacgcttaaagtattgtttttcaaattttacaacaattgaaaaatatagaggctgctttatttgc |
8794575 |
T |
 |
| Q |
101 |
ttttgttttgtggagtatttgaaaatacagaaacaatcaaatttggaataatttggttgatgatcagtttatggttgttgaacggtctagtgtgctgcaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8794576 |
ttatgttttgtggagtatttgaaaatacagaaacaatcaaatttggaataatttggttgatgatcagtttatggttgttgaacggtctagtgagctgcaa |
8794675 |
T |
 |
| Q |
201 |
gaatgaaaatcagttagacaaatcgtattttatctaatccgaatcagaccaatatactactatttgaggatggcataaaccatcggtgggacatgttaa |
299 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8794676 |
gaatgaaaatcagttaaacaaatcgtattttatctaatccgaatcagaccaatataatactatttgaggatggcataaaccatcggtgggacatgttaa |
8794774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University