View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1097_high_12 (Length: 250)
Name: NF1097_high_12
Description: NF1097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1097_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 83 - 250
Target Start/End: Original strand, 42233101 - 42233268
Alignment:
| Q |
83 |
agtttaggtcaaatgaaaacttaattagggcgattggagactagttaactatatgaggtgaatcctttaggtctagacttttattttatctttgaaatag |
182 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42233101 |
agtttaggtcgaatgaaaacttaattagggcgaatggagactagttaactatatgaggtgaatcctttaggtctagacttttattttatctttgaaatat |
42233200 |
T |
 |
| Q |
183 |
atttcaagatagttgtgaatgacatccataaacatattattccaagtttggagatatcattaacgatt |
250 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42233201 |
atttcaagatagctgtgaatggcatccataaacatattattccaagtttggagatatcattaacgatt |
42233268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 42235078 - 42235037
Alignment:
| Q |
30 |
aatgaatcttaccatcactcactttgaaatatatcaacaact |
71 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42235078 |
aatgaatcttaccatcaatcactttgaaatatatcaagaact |
42235037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University