View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1097_low_13 (Length: 268)
Name: NF1097_low_13
Description: NF1097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1097_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 55397208 - 55397010
Alignment:
| Q |
23 |
caacaatatccaattcctctcatcacactcttctccgtctctattccccctcccttcctcaaaattcagcaccgttccttttcccacaccaatcagaaga |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55397208 |
caacaatgtccaattcctctcatcacactcttctccgtctctattccccctcccttcctcaaaattcagcaccgttccttttcccacaccaatcagaaga |
55397109 |
T |
 |
| Q |
123 |
agaacctccttttctactctcagattccgtagtttcactcgcagactcagaaactcgtcgacgaatgatgttaaactgaacgaaacggagcagaagaag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55397108 |
agaacctccttttctactctcagattccgtagtttcactcgcagactcagaaactcgtcgacgaatgatgttcaactgaacgaaacggagcagaagaag |
55397010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University