View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1097_low_18 (Length: 230)
Name: NF1097_low_18
Description: NF1097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1097_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 69 - 123
Target Start/End: Original strand, 12933329 - 12933383
Alignment:
| Q |
69 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaggatggagag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12933329 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaagatggagag |
12933383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 69 - 123
Target Start/End: Original strand, 14176599 - 14176653
Alignment:
| Q |
69 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaggatggagag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14176599 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaagatggagag |
14176653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 69 - 123
Target Start/End: Complemental strand, 28609277 - 28609223
Alignment:
| Q |
69 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaggatggagag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28609277 |
tgatggtgagccagtagttgaagatggtgatgatgaagatgttcaagatggagag |
28609223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 71 - 123
Target Start/End: Original strand, 15299121 - 15299173
Alignment:
| Q |
71 |
atggtgagccagtagttgaagatggtgatgatgaagatgttcaggatggagag |
123 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15299121 |
atggtgagttagtagttgaagatggtgatgaggaagatgttcaggatggagag |
15299173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University