View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10980_low_1 (Length: 383)
Name: NF10980_low_1
Description: NF10980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10980_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 373
Target Start/End: Original strand, 48248202 - 48248560
Alignment:
| Q |
18 |
agaattacaaactctgaattcttctcccacaggagctactactactattcc------attcccacgtttcaaacaagaagaaaatcaagatcaagaacgt |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48248202 |
agaattacaaactcttaattcttctcccacaggagctactactactattcctattccattcccacgtttcaaacaagaagaaaatcaaga------acgt |
48248295 |
T |
 |
| Q |
112 |
gagtctttggttaaaaagaaacgatcaaaacgaccgcgtattggta------acccacccactgaagaagaatatcttgctctctgtctcatcatgctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248296 |
gagtctttggttaaaaagaaacgatcaaaacgaccgcgtattggtattggtaacccacccactgaagaagaatatcttgctctctgtctcatcatgctct |
48248395 |
T |
 |
| Q |
206 |
cacaaagcaacaaacaaattgaatcatcaccgttgaagcagctcaatcacaagtgcagtgtttgtaacaaagcttttccatcttatcaagcacttggtgg |
305 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248396 |
cacaaagcaacaaccaaattcaatcatcaccgttgaagc---tcaatcacaagtgcagtgtttgcaacaaagcttttccatcttatcaagcacttggtgg |
48248492 |
T |
 |
| Q |
306 |
tcacaaagccagccaccgcaaatcttcatcggaaaaccaatccacaaccgtcaacgagaccgtctctg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48248493 |
tcacaaagccagccaccgcaaatcttcatcggaaaaccaatccacaaccgtcaacgagaccatctctg |
48248560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 5294569 - 5294607
Alignment:
| Q |
165 |
cactgaagaagaatatcttgctctctgtctcatcatgct |
203 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
5294569 |
cactgaagaagaatatctcgctctttgtctcatcatgct |
5294607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 323
Target Start/End: Complemental strand, 47436080 - 47436028
Alignment:
| Q |
271 |
aacaaagcttttccatcttatcaagcacttggtggtcacaaagccagccaccg |
323 |
Q |
| |
|
|||||||||||| ||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
47436080 |
aacaaagctttttcatcttatcaagccctaggtggacacaaagccagtcaccg |
47436028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University