View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10980_low_6 (Length: 216)

Name: NF10980_low_6
Description: NF10980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10980_low_6
NF10980_low_6
[»] scaffold0252 (1 HSPs)
scaffold0252 (1-191)||(20585-20775)
[»] chr4 (3 HSPs)
chr4 (1-192)||(43435101-43435292)
chr4 (1-191)||(43426597-43426787)
chr4 (135-200)||(43440960-43441025)


Alignment Details
Target: scaffold0252 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: scaffold0252
Description:

Target: scaffold0252; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 20775 - 20585
Alignment:
1 ccaaccacctttttgacaacattccgcattgcattttgctcaagcatccctttataacaatatggaagcacaacaacatcactccacaactcctcccttt 100  Q
    |||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||  ||| || |||| ||||||||||||||  ||||| ||||| ||    
20775 ccaaccacctttttgacaacattctgcattgcattctgctcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttctcccctt 20676  T
101 ttaaactcgtcgaaatcgtcaaatgtgtctcttcatctaaatagaaccctttatccatcatagccttaagaacaatccaaaactctttcat 191  Q
    |||||||| | |||||||||| |||||||||||||||||||||||||||||| ||  |||||||| |||||||||||||||||||||||||    
20675 ttaaactccttgaaatcgtcacatgtgtctcttcatctaaatagaaccctttttctttcatagccctaagaacaatccaaaactctttcat 20585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 43435292 - 43435101
Alignment:
1 ccaaccacctttttgacaacattccgcattgcattttgctcaagcatccctttataacaatatggaagcacaacaacatcactccacaactcctcccttt 100  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||  ||| || |||  |||||| |||||||  ||| | ||||||||    
43435292 ccaaccacctttttaacaacattctgcattgcattttgctcaagcatccctttatagaaatgtgaaagtgcaacaatatcactcttcaaattctcccttt 43435193  T
101 ttaaactcgtcgaaatcgtcaaatgtgtctcttcatctaaatagaaccctttatccatcatagccttaagaacaatccaaaactctttcatc 192  Q
    | |||| ||| |||||||||||||  ||||||||||||||||| |||||||| ||| |||||||| ||||||||||||||||||||||||||    
43435192 tcaaacccgtagaaatcgtcaaatacgtctcttcatctaaataaaaccctttttccttcatagccctaagaacaatccaaaactctttcatc 43435101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 43426787 - 43426597
Alignment:
1 ccaaccacctttttgacaacattccgcattgcattttgctcaagcatccctttataacaatatggaagcacaacaacatcactccacaactcctcccttt 100  Q
    ||||||||||||||||||||| || |||||||||  ||||||||||||||||||||  ||  || |  | ||||||||||||||  || || | || |||    
43426787 ccaaccacctttttgacaacactctgcattgcatcctgctcaagcatccctttatagaaacgtgaatactcaacaacatcactcttcatcttcgcctttt 43426688  T
101 ttaaactcgtcgaaatcgtcaaatgtgtctcttcatctaaatagaaccctttatccatcatagccttaagaacaatccaaaactctttcat 191  Q
    | |||   | |||||   ||||||||||||||||||||||||| ||||| || ||| ||||||||||||||||||||||||||||||||||    
43426687 tcaaatctgccgaaagtatcaaatgtgtctcttcatctaaataaaacccattttccttcatagccttaagaacaatccaaaactctttcat 43426597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 135 - 200
Target Start/End: Complemental strand, 43441025 - 43440960
Alignment:
135 atctaaatagaaccctttatccatcatagccttaagaacaatccaaaactctttcatcgtcttgtt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
43441025 atctaaatagaaccctttatccatcatagccttaagaacaatccaaaactctttcatcttcttgtt 43440960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University