View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10981_high_4 (Length: 249)

Name: NF10981_high_4
Description: NF10981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10981_high_4
NF10981_high_4
[»] chr5 (1 HSPs)
chr5 (18-241)||(13231493-13231716)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 13231493 - 13231716
Alignment:
18 gatttgttgcatgatataacaggttatgcaccaaagggttgtatcactgcagtaatgggaccaagtggtgctggaaaatcaactttattggatggacttg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13231493 gatttgttgcatgatataacaggttatgcaccaaagggttgtatcactgcagtaatgggaccaagtggtgctggaaaatcaactttattggatggacttg 13231592  T
118 ctgggagaattgcaagtgggagtcttaaaggaaaagtttcattggatggaattagtgtgaatgcaagcttgattaaaagaacttctgcttatattatgca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
13231593 ctgggagaattgcaagtgggagtcttaaaggaaaagtttcattggatggaaatagtgtgaatgcaagcttgattaaaagaacttctgcttatattatgca 13231692  T
218 agaagataggctttttcctatgct 241  Q
    ||||||||||||||||||||||||    
13231693 agaagataggctttttcctatgct 13231716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University