View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10981_low_9 (Length: 203)
Name: NF10981_low_9
Description: NF10981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10981_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 26 - 188
Target Start/End: Complemental strand, 45315278 - 45315116
Alignment:
| Q |
26 |
accacgctttctccattggagggtgtgatttgagaacctgattgacagtgtatgagtcccatttcaaagggagattttgaagctgttgttgagcggaatc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45315278 |
accacgctttctccattggagggtgtgatttgagaacctgattgacagtgtatgagtcccatttcaaagggagattttgaagctgttgttgagcggaatc |
45315179 |
T |
 |
| Q |
126 |
ccaagatgaatactttagggttctgtaaatattcccaattacgttcctcatgtactctctgct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45315178 |
ccaagatgaatactttagggttctgtaaatattcccaattacgttcctcatgtactctctgct |
45315116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University