View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10982_high_26 (Length: 270)
Name: NF10982_high_26
Description: NF10982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10982_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 30 - 254
Target Start/End: Original strand, 40488212 - 40488441
Alignment:
| Q |
30 |
cttttgtgaatgggctcttgtgctacgtgtgtattggtaaatgggttggtaacccatgtgtgtgttaagtgatataaaagggaatcataatccctagt-- |
127 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40488212 |
cttttatgaatgggctcttgtgctacgtgtgtattggtaaatgggttggtaacccatgtgtgtgttaagtgatataaaagggaatcataatccctagttg |
40488311 |
T |
|
| Q |
128 |
----attggtgcgtgagcaaaaattgaggcgcacagtaagataattttgagagagagcagcacgccaaagaggaagaagattttggataccggtgaaaaa |
223 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40488312 |
cagtattggtgcgtgag-aaaaattgtggcgcacagtaagataattttgagagagagcaacacgccacagaggaagaagattttggataccggtgaaaaa |
40488410 |
T |
|
| Q |
224 |
agtatattttgcgaactatctttgtttagat |
254 |
Q |
| |
|
||||||||| || |||||||||||||||||| |
|
|
| T |
40488411 |
agtatatttggcaaactatctttgtttagat |
40488441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 254
Target Start/End: Original strand, 40488453 - 40488489
Alignment:
| Q |
218 |
gaaaaaagtatattttgcgaactatctttgtttagat |
254 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
40488453 |
gaaaaaagtatatttggcaaactatctttgtttagat |
40488489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University