View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10982_high_35 (Length: 202)
Name: NF10982_high_35
Description: NF10982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10982_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 40584164 - 40584335
Alignment:
| Q |
13 |
tgtggaggagaggggctacaaccgtagcaaaaatatgcaccaaatgagtgtgatcgagaagaagagtagttttgaattagaaggatccactcttttctac |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40584164 |
tgtggcggagaggggctacaaccgtagcaaaaatatacaccaaatgagtgtgattgagaagaagagtagttttgaattagaaggatccactcttttctac |
40584263 |
T |
|
| Q |
113 |
gtttatgtaaaaatcggagaattaacttttttcaaatacacatgaacaattagttgagagttggggttagatt |
185 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40584264 |
gtttatgt-aaaatcggagaattaacttttttcaaatacacatgaacaattagttgagagttggggttagatt |
40584335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University