View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10982_low_30 (Length: 263)
Name: NF10982_low_30
Description: NF10982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10982_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 33019972 - 33020217
Alignment:
| Q |
1 |
ggcacgggcaggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtagatatgcccactgtccctgttgaacgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33019972 |
ggcacgggcaggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtagatatgcccactgtccctgttgaacaggt |
33020071 |
T |
|
| Q |
101 |
tcaattggagttacatccagtgcaacatgggactttgtccgacagagcctatgcttggtctcaacactctttgatatgctacctagtcgatttttcatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33020072 |
tcaattggagttacatccagtgcaacatgggactttgtccgacagagcctatgcttggtctcaacactctttgatatgctacctagtcgatttttcatgc |
33020171 |
T |
|
| Q |
201 |
ccttgagtttgcagactatgtttttcaatgacatgcttccacactg |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33020172 |
ccttgagtttgcagactatgattttcaatgacatgcttccacactg |
33020217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 32828826 - 32828584
Alignment:
| Q |
2 |
gcacgggcaggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtagatatgcccactgtccctgttgaacgggtt |
101 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||| ||||| ||||||| |||| |
|
|
| T |
32828826 |
gcacgagcaggccaagatgtctcactctcttcaaccctacggattatgtccaaaagcaattcaggaggtagactcgcccattgtccttgttgaataggtt |
32828727 |
T |
|
| Q |
102 |
caattggagttacatccagtgcaacatgggactttgtccgacagagcctatgcttggtctc---aacactctttgatatgctacctagtcgatttttcat |
198 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||| |||||| |||| || |||||| || | | | |||||||||||||||| || ||||||||| |
|
|
| T |
32828726 |
caattggagttacatccggagcaacatgcgactttgaccgacatagccaattcttggtgtcggaaccccgttttgatatgctacctattccatttttcat |
32828627 |
T |
|
| Q |
199 |
gcccttgagtttgcagactatgtttttcaatgacatgcttcca |
241 |
Q |
| |
|
|||||||||| || |||||| |||| ||||||||| ||||| |
|
|
| T |
32828626 |
ccccttgagttcgcggactatacttttgaatgacatgtttcca |
32828584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 2 - 157
Target Start/End: Original strand, 33041107 - 33041262
Alignment:
| Q |
2 |
gcacgggcaggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtagatatgcccactgtccctgttgaacgggtt |
101 |
Q |
| |
|
||||| ||||||||| ||||| |||||| ||||||||| |||||||| |||||||||||||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
33041107 |
gcacgtgcaggccaaaatgtctcactcttttcaacccttcggattatgtccaaaagcaattcaggtggtagacttgcccattgtccctgttgaataggtt |
33041206 |
T |
|
| Q |
102 |
caattggagttacatccagtgcaacatgggactttgtccgacagagcctatgcttg |
157 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||| |||||||| | |||||||| |
|
|
| T |
33041207 |
caattggagttacatccagagcaacgtgggaatttgaccgacagaacatatgcttg |
33041262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 33026021 - 33026092
Alignment:
| Q |
2 |
gcacgggcaggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtaga |
73 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
33026021 |
gcacgtgcaggccaagatgtctcactttcttcaaccttacggattatgtccaaaagcaattcacgtggtaga |
33026092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 174 - 245
Target Start/End: Original strand, 33041267 - 33041338
Alignment:
| Q |
174 |
atatgctacctagtcgatttttcatgcccttgagtttgcagactatgtttttcaatgacatgcttccacact |
245 |
Q |
| |
|
|||||||||||| || |||||| || ||||||||||||| | ||| | ||||| |||||||| ||||||||| |
|
|
| T |
33041267 |
atatgctacctattccattttttatccccttgagtttgcggcctaagcttttcgatgacatgtttccacact |
33041338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University