View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10982_low_7 (Length: 514)
Name: NF10982_low_7
Description: NF10982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10982_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 186 - 495
Target Start/End: Complemental strand, 3361989 - 3361682
Alignment:
| Q |
186 |
caggaaatagttacttgcatttcatacatggcttttaatctatggagttcatcttttgatcaaggtttcttattttacctcatctttggttattaattat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361989 |
caggaaatagttacttgcatttcatacatggcttttaatctatggagttcatcttttgatcaaggtttcttattttacctcatctttggttattaattat |
3361890 |
T |
|
| Q |
286 |
ctatatcagttttggtgttatacttatatgataaatgagtttatatctttttgcatgtactttgctggtgttagtttcctatgatggtaactactctgag |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3361889 |
ctatatcagttttggtgttatacttatatgataaatgagtttatatctttttgcatgtactttgctggtgttagtttcctatgatggtaactactct--g |
3361792 |
T |
|
| Q |
386 |
agtcttgagtgccattatgattactttcactgtggatatggtatttattcttatactttctctccctctattttgtttggccctttttaggtgtctctat |
485 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361791 |
agtcttgagtgccactatgattactttcactgtggatatggtatttattcttatactttctctccctctattttgtttggccctttttaggtgtctctat |
3361692 |
T |
|
| Q |
486 |
gttggtactt |
495 |
Q |
| |
|
|||||||||| |
|
|
| T |
3361691 |
gttggtactt |
3361682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 3362178 - 3362023
Alignment:
| Q |
1 |
ttgaagaagaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatttatt----cctttttgttctctgtt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3362178 |
ttgaagaagaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatttatttattcctttttgttctctgtt |
3362079 |
T |
|
| Q |
97 |
gcatttctattgttgatgcttctttggattaataatagtattagataaattcgtga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3362078 |
gcatttctattgttgatgcttctttggattaataatagtattagataaattcgtga |
3362023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University