View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10983_high_8 (Length: 338)
Name: NF10983_high_8
Description: NF10983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10983_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 74 - 297
Target Start/End: Complemental strand, 36932584 - 36932361
Alignment:
| Q |
74 |
gacattgtatgagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacg |
173 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36932584 |
gacattgtaagagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttgacg |
36932485 |
T |
|
| Q |
174 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttccttgattttcgttctctgttgctagttgcttcaatgcgtctctt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36932484 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgcctctt |
36932385 |
T |
|
| Q |
274 |
gctgttgcaggcaacaaaacaaaa |
297 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36932384 |
gctgttgcaggcaacaaaacaaaa |
36932361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 119 - 229
Target Start/End: Complemental strand, 990422 - 990312
Alignment:
| Q |
119 |
taactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990422 |
taactgttccatggctttgagccaaacaggttcggccatggccaaacccttgacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
990323 |
T |
|
| Q |
219 |
gttcccacttc |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
990322 |
gttcccacttc |
990312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University