View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10984_high_4 (Length: 315)
Name: NF10984_high_4
Description: NF10984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10984_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 29296138 - 29296436
Alignment:
| Q |
1 |
ttggatcggagaatctttgtgacgtgtggttgaagttcgaagttgttgatgagtgatttcttttgggattgtttaatgcgtcttcttttgtgtggccttt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29296138 |
ttggatcggagaatctttgtgacatgtggttgaagttcgaagttgttgatgagtgatttcttttgggattgtttaatgcgtcttcttttgtgtggtcttt |
29296237 |
T |
 |
| Q |
101 |
cttctaagaagtcgcgtgttggtggtagtagttccgatgggaatggattacggagggaggcttgtggcggannnnnnnnnnnnnnnnnnnnnnnnnaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29296238 |
cttctaagaagtcgcgtgttggtggtagtagttccgatgggaatggattacggagggaggcttgtggcggaggtggtggcggtggtggtggtggtgaaga |
29296337 |
T |
 |
| Q |
201 |
aggtggcgaaatggagttggaggttgaagccattgttgagagggttttcgaacttcgaagtttgagcgcggttttttgagggaaaaataactgtcaatt |
299 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29296338 |
aggtggcgagatggagttggaggttgaagccatggttgagagggttttcgaacttcgaagtttgagcgcggtgttttgagggaaaaataactgtcaatt |
29296436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University