View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10984_low_6 (Length: 226)

Name: NF10984_low_6
Description: NF10984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10984_low_6
NF10984_low_6
[»] chr8 (6 HSPs)
chr8 (19-211)||(38799255-38799447)
chr8 (19-211)||(38822070-38822262)
chr8 (19-209)||(43479850-43480040)
chr8 (18-211)||(25865460-25865653)
chr8 (18-211)||(26591928-26592121)
chr8 (19-211)||(41943704-41943896)
[»] chr2 (4 HSPs)
chr2 (19-209)||(13576110-13576300)
chr2 (18-92)||(34571621-34571695)
chr2 (18-95)||(34579089-34579166)
chr2 (18-95)||(34584838-34584915)
[»] chr7 (3 HSPs)
chr7 (19-209)||(21317336-21317526)
chr7 (19-209)||(3930137-3930327)
chr7 (37-143)||(3928803-3928909)
[»] chr5 (5 HSPs)
chr5 (17-211)||(12531252-12531446)
chr5 (17-211)||(12547173-12547367)
chr5 (40-209)||(9866853-9867024)
chr5 (40-143)||(9869843-9869946)
chr5 (106-170)||(9894450-9894514)
[»] scaffold0197 (1 HSPs)
scaffold0197 (40-209)||(30774-30943)
[»] chr4 (2 HSPs)
chr4 (18-211)||(34748515-34748708)
chr4 (19-211)||(24860306-24860498)
[»] chr1 (2 HSPs)
chr1 (152-211)||(7594905-7594964)
chr1 (22-74)||(7594438-7594490)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 38799447 - 38799255
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  38799447 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggcttcttca 38799348  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  38799347 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38799255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 38822070 - 38822262
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  38822070 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggcttcttca 38822169  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  38822170 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38822262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 43479850 - 43480040
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    ||||||||||| || | |||||||||||| || |||||||||||||| |||||||| |  | |||||| |||||||| | |||||| |||||||||||||    
T  43479850 tggaatggaagcttcctgatgagaagctcggtactcttctgatacttgcggatctcacgaagagcaacagttccaggacggaatctgtgtggcttcttca 43479949  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    |||||||||| ||||||||||||||||||||||| ||||||||||| || ||||  ||||| || || ||||||||||||||||| |||||    
T  43479950 ctcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgccaccggtggatttgcgagcggtttg 43480040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 25865653 - 25865460
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 117  Q
    |||||||||||| |||||||| | ||||||||| ||||||||||||||||||||||| |  | |||||| |||||||| |   | | ||| |||||||||    
T  25865653 ctggaatggaagcttacggatcaaaagctcagtactcttctgatacttacggatctcacgaagagcaacggttccaggacgataacgatgaggcttcttc 25865554  T
Q  118 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    ||||| ||||| |  ||||| |||||||  || || ||||| ||||| |||||||  || ||||| |||||||||||||||||||| |||||||    
T  25865553 actccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgccgccggtggatttgcgagcagtttgct 25865460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 26592121 - 26591928
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 117  Q
    |||||| |||||||| || |||||||| || ||||||||||| ||||| |||||||| |  |  || || ||||| || ||||| |  ||||||||||||    
T  26592121 ctggaaaggaagtttgcgaatgagaagttcggtgctcttctggtacttgcggatctcacggagtgcgacggttcctggcctgaaacggtgtggcttcttc 26592022  T
Q  118 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    ||||| |||||||||||||| |||||||||||||| || || |||||||||||||  || || || ||||||||||| ||||| || |||||||    
T  26592021 actccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttgcgtgcagtttgct 26591928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 41943896 - 41943704
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    ||||||||||| |||||||| | ||| ||||| |||||||| || ||||||||||| |  |  ||||| || ||||| |   | | ||| || ||||| |    
T  41943896 tggaatggaagcttacggatcaaaagatcagtactcttctggtatttacggatctcacgaagtgcaacggtaccaggacgatagcgatgaggtttcttga 41943797  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    |||| ||||| |  ||||| ||||| ||||| ||||||||||| || |||||||  |||||||| || ||||||||||||||||| |||||||    
T  41943796 ctccaccggttgtaggagcagatttgcgagcagccttggtggccagttgcttccttggagccttgccaccggtggatttgcgagcagtttgct 41943704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 13576300 - 13576110
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    ||||||||||| || |  ||||||||||| ||||||||||||||||| ||||| || |  | ||| || |||||||| | ||| | ||||||||||||||    
T  13576300 tggaatggaagcttccttatgagaagctcggtgctcttctgatacttgcggatttcacgaagagcgacggttccaggacggaaacgatgtggcttcttca 13576201  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    |||||||||| |||||||| |||||||||||||| || |||||||| || || || || || |||||||||||||||||||| ||||||||    
T  13576200 ctcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttccgccggtggatttgcgggctgtttg 13576110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 92
Target Start/End: Original strand, 34571621 - 34571695
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttcc 92  Q
    ||||||||||||||||||||| | ||| || || ||||||||||||||||| ||||| |  | ||||||||||||    
T  34571621 ctggaatggaagtttacggatcaaaagttcggtactcttctgatacttacgtatctcacgaagagcaactgttcc 34571695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 34579089 - 34579166
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccagg 95  Q
    |||||||||||||||||| || | ||| || || | ||||||||||||||| ||||| |  | |||||||||||||||    
T  34579089 ctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccagg 34579166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 34584838 - 34584915
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccagg 95  Q
    |||||||||||||||||| || | ||| || || | ||||||||||||||| ||||| |  | |||||||||||||||    
T  34584838 ctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccagg 34584915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 21317526 - 21317336
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    |||||||||||||| |  || |||||||||||||||||||| ||||| ||||| || |  |  || || ||||| || | ||| |  |||||||||||||    
T  21317526 tggaatggaagttttcttatcagaagctcagtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttca 21317427  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||| || || || || || |||||||||||||||||||| ||||||||    
T  21317426 ctcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttg 21317336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 3930137 - 3930327
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    |||||||||||||| |  |||||||| |||||||||||||||||||| |||||||| |  |  || |||||||| || | |||||| ||||| ||||| |    
T  3930137 tggaatggaagtttcctaatgagaagttcagtgctcttctgatacttgcggatctcacgaagtgcgactgttcctggacggaatctgtgtggtttcttta 3930236  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    | || ||||| ||||| |||||||| |  ||||| ||||||||||| || ||||| || || ||||| ||||||||||| || ||||||||    
T  3930237 caccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtttccgtggggcttttcctccggtggattttcgtgctgtttg 3930327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 37 - 143
Target Start/End: Original strand, 3928803 - 3928909
Alignment:
Q  37 atgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggag 136  Q
    ||||||||||||||| |||| |||||||| | ||| || | ||| || |||||||| ||||||||||| ||||||||||||| |||||| |||||| | |    
T  3928803 atgagaagctcagtgatcttttgatacttcctgatttcacgcaatgcgactgttcctggtctgaatctgtgtggcttcttcattcctcctgtcgccagtg 3928902  T
Q  137 ctgattt 143  Q
    |||||||    
T  3928903 ctgattt 3928909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 12531446 - 12531252
Alignment:
Q  17 tctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttctt 116  Q
    ||||||||||||| || |  || |||||||| ||||||||||| ||||| |||||||| |  |  ||||| ||||| || | |||||| |||||||||||    
T  12531446 tctggaatggaagcttccttataagaagctcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttctt 12531347  T
Q  117 cactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
     ||||||||||| |||||||| |||||||| || || || ||||| ||||||||||  || || |||||||||||||||||||||||||||||||    
T  12531346 gactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12531252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 12547173 - 12547367
Alignment:
Q  17 tctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttctt 116  Q
    ||||||||||||| || |  || |||||||| ||||||||||| ||||| |||||||| |  |  ||||| ||||| || | |||||| |||||||||||    
T  12547173 tctggaatggaagcttccttataagaagctcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttctt 12547272  T
Q  117 cactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
     ||||||||||| |||||||| |||||||| || || || ||||| ||||||||||  || || |||||||||||||||||||||||||||||||    
T  12547273 gactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12547367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 40 - 209
Target Start/End: Original strand, 9866853 - 9867024
Alignment:
Q  40 agaagctcagtgctcttctgatact--tacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagc 137  Q
    ||||||||| ||||||| || ||||  |||||||||| |  |  ||||| |||||||| | ||| |  |||||||||||||||||||| || ||||||||    
T  9866853 agaagctcaatgctcttttggtactcttacggatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagc 9866952  T
Q  138 tgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    |||||||||||| || || ||||| |||| ||| |  || || || |||||||||||||||||||| |||||    
T  9866953 tgatttccgagcagcttttgtggccagcttctttcatggtgctttaccgccggtggatttgcgagccgtttg 9867024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 143
Target Start/End: Complemental strand, 9869946 - 9869843
Alignment:
Q  40 agaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctg 139  Q
    |||||||||||||||||||| |||||||||||||| |  | |||||| |||||| | | ||| |  ||||| ||||||||| | ||||| ||| ||||||    
T  9869946 agaagctcagtgctcttctggtacttacggatctcacgaagagcaacggttccatgacagaaacagtgtggtttcttcactgccccggttgccagagctg 9869847  T
Q  140 attt 143  Q
    ||||    
T  9869846 attt 9869843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 9894514 - 9894450
Alignment:
Q  106 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgctt 170  Q
    |||||||||||||||  |||||  ||| |||||||||| |||||||| |||||||| ||||||||    
T  9894514 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctt 9894450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 40 - 209
Target Start/End: Complemental strand, 30943 - 30774
Alignment:
Q  40 agaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctg 139  Q
    |||||||||||||||||||| ||||| ||||| || |  |  || || ||||| || | ||| |  ||||||||||||||||||||||||||||||||||    
T  30943 agaagctcagtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctg 30844  T
Q  140 atttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 209  Q
    ||||||| ||||| ||||||||||| || || || || || |||||||||||||||||||| ||||||||    
T  30843 atttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttg 30774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 34748708 - 34748515
Alignment:
Q  18 ctggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 117  Q
    |||||| || ||||| |||||||| || || ||||||||||| |||||||||||||| |  | ||| || ||||| |||||||| |  || || ||||||    
T  34748708 ctggaaggggagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacgtagagcgacggttcctggtctgaaacggtgaggtttcttc 34748609  T
Q  118 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    ||||| ||||| |||||||| ||||| |||||||| || ||||| || |||||||  ||||| || || || |||||||||||||| |||||||    
T  34748608 actccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttgcgagcggtttgct 34748515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 24860498 - 24860306
Alignment:
Q  19 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 118  Q
    |||||||||||||| |||||||||||||| ||||| || || ||||| ||||| || |  |  ||||| ||||| || | ||| |  || || |||||||    
T  24860498 tggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcgaagtgcaacggttccgggacggaaacggtgaggtttcttca 24860399  T
Q  119 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    |||| ||||| || ||||| |||||||| ||||| || || || ||||||||||  || || ||||| |||||||||||||||||||||||||    
T  24860398 ctccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 24860306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 211
Target Start/End: Original strand, 7594905 - 7594964
Alignment:
Q  152 ccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 211  Q
    |||||||||||||||||||||  |||||||| || ||||| || |||||||| |||||||    
T  7594905 ccttggtggcgagctgcttccttggagccttaccaccggtagacttgcgagcggtttgct 7594964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 74
Target Start/End: Original strand, 7594438 - 7594490
Alignment:
Q  22 aatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctc 74  Q
    |||||||| || ||||| | ||||||||| |||||||| ||||||||||||||    
T  7594438 aatggaagcttgcggatcaaaagctcagtactcttctggtacttacggatctc 7594490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University