View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10985_high_6 (Length: 337)
Name: NF10985_high_6
Description: NF10985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10985_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 6 - 81
Target Start/End: Original strand, 40643450 - 40643525
Alignment:
| Q |
6 |
attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40643450 |
attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctt |
40643525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University