View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10985_high_8 (Length: 230)
Name: NF10985_high_8
Description: NF10985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10985_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 40643175 - 40643376
Alignment:
| Q |
17 |
cacttttgacatctttaaacttcacaaagccaaatcttttacccactgatctaactttttcagaatatatacatcccccactctccccaaattgacgaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40643175 |
cacttttgacatctttaaacttcacaaagccaaatcttttacccactggtctaactttttcagaatacatacatcccccactctccccaaattgacgaac |
40643274 |
T |
 |
| Q |
117 |
aacttccatacaagtaaatcaaaccaacctaatctaatatatttttaaactagaatgatgttaagctcttaggaaggttatggatgagcccccttcttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40643275 |
aacttccatacaagtaaatcaaaccaacctaatctaatatatttttaaactagaatgaagttaagctcttaggaaggttatggatgagcccccttcttct |
40643374 |
T |
 |
| Q |
217 |
ct |
218 |
Q |
| |
|
|| |
|
|
| T |
40643375 |
ct |
40643376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University