View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10985_high_9 (Length: 225)
Name: NF10985_high_9
Description: NF10985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10985_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 13867857 - 13867670
Alignment:
| Q |
17 |
cacagaactgcaatgtgtttatgtccggatcaatggtgaagcctatgatgaaggtaaacttgggatagacatcgctacggagttggagcgccttttcgat |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13867857 |
cacagaactgcaacgtgtttatgtccggatcaatggcgaagcctaagatgaaggtaaacttgggatagacatcgctacggagttggagcgccttttcgat |
13867758 |
T |
|
| Q |
117 |
ccaggtttggacgacggaggcaacggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatgatccacgt |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13867757 |
ccaggtttggacga-ggaggcaacggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatgatccacgt |
13867670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 11876557 - 11876614
Alignment:
| Q |
140 |
cggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| || ||||||||| |||| |
|
|
| T |
11876557 |
cggaagtaactgtgacgatgatattggtatcgtacaggtttacaatgtaaatgttatg |
11876614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University