View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10985_low_10 (Length: 231)
Name: NF10985_low_10
Description: NF10985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10985_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 49126222 - 49126426
Alignment:
| Q |
1 |
ctacaaaatcttagttgtctgttacatgcgtttagatgttccaagcaaggatttcttatatcaaaattcagtagctgttacataggctttttgacagacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49126222 |
ctacaaaatcttagttgtctgttacatgcgtttagatgttccaagcaaggatttcttatatcaaaattcagtagctgttacataggctttttgacagacg |
49126321 |
T |
|
| Q |
101 |
gagttagcgataaggtccaaaactgaaacattttcataaatgagaaacccaaatgtga---gnnnnnnnntgaaaattatcatattttgagggacaacag |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
49126322 |
gagttagctataaggtccaaaactgaaacattttcataaatgagaaacccaaatgtgaaagaaaaaaaaatgaaaattatcatattttgagggacaacgg |
49126421 |
T |
|
| Q |
198 |
acata |
202 |
Q |
| |
|
||||| |
|
|
| T |
49126422 |
acata |
49126426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University