View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10986_low_11 (Length: 228)
Name: NF10986_low_11
Description: NF10986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10986_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 220
Target Start/End: Original strand, 47162477 - 47162696
Alignment:
| Q |
4 |
tgaatgaaaggagactctagatttcaaacagtttattcaagttat---gtttccaaccagacaagaccagtttcttggtacgatttgttacagaaaccaa |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162477 |
tgaatgaagggagactctagatttcaaacagtttattcaagttattatgtttccaaccagacaagaccagtttcttggtacgatttgttacagaaaccaa |
47162576 |
T |
|
| Q |
101 |
acttaggagagtactagtttcatttcatctaaaggttttacccccagaatagtaagtaatattactataattgatttgttatctcaactttcagatatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47162577 |
acttaggagagtactagtttcatttcatctaaaggttttactcccagaatagtaagtaatattactataattgatttgtgatctcaactttcagatatct |
47162676 |
T |
|
| Q |
201 |
ctatgtcttgtgttcttctc |
220 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
47162677 |
ctatgtcttttgttcttctc |
47162696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University