View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10986_low_6 (Length: 412)

Name: NF10986_low_6
Description: NF10986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10986_low_6
NF10986_low_6
[»] chr1 (2 HSPs)
chr1 (1-140)||(47162881-47163020)
chr1 (282-412)||(47162673-47162803)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 47163020 - 47162881
Alignment:
1 tcatcacaaaagaagactagtactaaagaattgagggccccttcccttattggaagaaccagtggttaattttcaattttgaaattgaaaaattcaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
47163020 tcatcacaaaagaagactagtactaaagaattgagggccccttcccttattggaagaaccagtggttaattttcaattttgaaattgaaaaattcaacca 47162921  T
101 atgaactatggacaacttggatgaaattttctgcactgcc 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
47162920 atgaactatggacaacttggatgaaattttctgcactgcc 47162881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 282 - 412
Target Start/End: Complemental strand, 47162803 - 47162673
Alignment:
282 ctcagtgtaaccaaaaagaaaacaaaagagactttaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga 381  Q
    |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47162803 ctcaatgtaaccaaaaagaaaacaaaagagacttaaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga 47162704  T
382 gtcatgggagaagaacacaagacatagagat 412  Q
    ||||||||||||||||| |||||||||||||    
47162703 gtcatgggagaagaacaaaagacatagagat 47162673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University