View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10986_low_8 (Length: 333)
Name: NF10986_low_8
Description: NF10986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10986_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 319
Target Start/End: Original strand, 38791828 - 38792136
Alignment:
| Q |
11 |
cagagatggaaaatgggttcttctctgtgaagttcgcaactgaagaagattacaatcatgccctttacaacggaccttggatggtggctgattcttatct |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791828 |
cagatatggaaaatgggttcttctctgtgaagttcgcaactgaagaagattacaatcatgccctttacaacggaccttggatggtggctgattcttatct |
38791927 |
T |
 |
| Q |
111 |
cttgttacaacgttggcgacccnnnnnnncgctaactcccgaacatagggttgcggtagtttggattagaatactcaagctacctatggaacccgccttt |
210 |
Q |
| |
|
||||||| || ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791928 |
cttgttataaagttggcgaccctttttttcgctaaccgccgaacatagggttgcggtagtttggattagaatactcaagctacctatggaacccgccttt |
38792027 |
T |
 |
| Q |
211 |
tctttcgaggataggatcaactttttgggggtgatgttgaaggttgatgataggctaagtgggaaatacgcgagaatatgtgtggagatagatttggata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792028 |
tctttcgaggataggatcaactttttgggggtgatgttgaaggttgatgataggctaagtgggaaatacgcgagaatatgtgtggagatagatttggata |
38792127 |
T |
 |
| Q |
311 |
gacgtttgt |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
38792128 |
gacgtttgt |
38792136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University