View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10986_low_9 (Length: 250)
Name: NF10986_low_9
Description: NF10986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10986_low_9 |
 | |
|
| [»] scaffold1787 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 21354621 - 21354391
Alignment:
| Q |
3 |
gtcgccgcgtcctgaaatagaaatttgaattgacattggtacatcatgatgcacagcttggacattaaggttcgccctgctattgctgcattagtgaaca |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
21354621 |
gtcgccgcctcctgaaatagaaatttgaattgacattggtacatcatgatgcacagcttggacattaaggttcacccttctattgctgcattagtgaaca |
21354522 |
T |
|
| Q |
103 |
aagtttgtgtggaaaaattctggtggaattaaaggaatatttgtgtttacattttcattttcagtcacttggttgaagttaaccgggatacatcgcgatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
21354521 |
aagtttgtgtggaaaaattctggtggaattaaaggaatatttgtgtttacattttcattttcagtcacttagttgaagttaaccgggatagatcgcgatt |
21354422 |
T |
|
| Q |
203 |
atgctacgatggtcggcgtacatgttctcaa |
233 |
Q |
| |
|
|||| |||||||||| | |||||||||||| |
|
|
| T |
21354421 |
gtgctgcgatggtcggtgcacatgttctcaa |
21354391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 30 - 182
Target Start/End: Complemental strand, 21174673 - 21174520
Alignment:
| Q |
30 |
aattgacattggtacatcatgatgcacagcttggacattaaggttcgccctgctattgctgcattagtgaacaaagtttgtgtggaaaaattctggtgga |
129 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||| |||| |||||||||||| | ||||||| |||||| |||| |||||||||| |
|
|
| T |
21174673 |
aattgacattggtacatcacgatgcacagcttggtcattaaggttcacccttttattgctgcattttttaacaaagattgtgttcaaaatttctggtgga |
21174574 |
T |
|
| Q |
130 |
attaaaggaatatt-tgtgtttacattttcattttcagtcacttggttgaagtt |
182 |
Q |
| |
|
||||||| || || |||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
21174573 |
attaaagaaaacttctgtgtttaaagtttcattttcagtcacttagttgaagtt |
21174520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 1289 - 1339
Alignment:
| Q |
49 |
tgatgcacagcttggacattaaggttcgccctgctattgctgcattagtga |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |||| |
|
|
| T |
1289 |
tgatgcacagcttggacattaaggttcacccttttattgccgcatttgtga |
1339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University