View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10987_high_7 (Length: 249)
Name: NF10987_high_7
Description: NF10987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10987_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 16470878 - 16470666
Alignment:
| Q |
24 |
atattgttcaattcaagcagccagtaacatatgttatcttgtaaggacggatgtgtttatctagtaggtttattttacagaacgaaaataaattaatttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16470878 |
atattgttcaattcaagcagccagtaacatatgttatcttgtaaggacggatgtgtttatctagtaggtttattttacagaacgaaaataaattaatttg |
16470779 |
T |
|
| Q |
124 |
catgaagtttggttctactattcaatgaaaagaaataaacaaacttctaaaatgcgtggatctcaggtgacctttaaccatcttaaaaatttctcttgca |
223 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
16470778 |
catgatgtttgattctactattcaataaaaagaaataaacaaacttctaaaatgcgtggatctcaagtgtcctttaaccatcttgaaaatttctcttgca |
16470679 |
T |
|
| Q |
224 |
agtttcttcatct |
236 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
16470678 |
agtctcttcatct |
16470666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 22 - 84
Target Start/End: Complemental strand, 16463745 - 16463683
Alignment:
| Q |
22 |
atatattgttcaattcaagcagccagtaacatatgttatcttgtaaggacggatgtgtttatc |
84 |
Q |
| |
|
||||| |||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16463745 |
atatactgttcaattcgaacagccagtaacctatgttatcttgtaaggacggatgtgtttatc |
16463683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University