View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10988_high_9 (Length: 208)
Name: NF10988_high_9
Description: NF10988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10988_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 6556946 - 6556766
Alignment:
| Q |
15 |
cacagatgagtaccaacaacgaaaatgactttcttaattagctttcagacacc------gaaaatggctaacattagttttaggtaacactaggtttaga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
6556946 |
cacaaatgagtaccaacaacgaaaatgactttcttaattagctttcagccaccaaaaacgaaaatgactaacattagttttaggtaagactaagtttaga |
6556847 |
T |
|
| Q |
109 |
tgaagattttggaagggaagagagatgaaaactaattttacttttttctttacgcattcttttctaaatttaggaacttgc |
189 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6556846 |
tgaaaattttggaagggaagagagatgaaaattaattttacttttttctttacgcattcttttctaaatttaggaacttgc |
6556766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University