View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10988_high_9 (Length: 208)

Name: NF10988_high_9
Description: NF10988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10988_high_9
NF10988_high_9
[»] chr7 (1 HSPs)
chr7 (15-189)||(6556766-6556946)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 6556946 - 6556766
Alignment:
15 cacagatgagtaccaacaacgaaaatgactttcttaattagctttcagacacc------gaaaatggctaacattagttttaggtaacactaggtttaga 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| ||||      ||||||| |||||||||||||||||||| |||| |||||||    
6556946 cacaaatgagtaccaacaacgaaaatgactttcttaattagctttcagccaccaaaaacgaaaatgactaacattagttttaggtaagactaagtttaga 6556847  T
109 tgaagattttggaagggaagagagatgaaaactaattttacttttttctttacgcattcttttctaaatttaggaacttgc 189  Q
    |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6556846 tgaaaattttggaagggaagagagatgaaaattaattttacttttttctttacgcattcttttctaaatttaggaacttgc 6556766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University