View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10989_low_1 (Length: 385)
Name: NF10989_low_1
Description: NF10989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10989_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 21 - 132
Target Start/End: Complemental strand, 7643932 - 7643821
Alignment:
| Q |
21 |
agaaaactcaaaagatacacattgtaatccattgtgttgtgtgaactgtttggaaaagtgagtatttgtgtgattttctttagctttacaactaatttgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7643932 |
agaaaactcaaaagatacacattgtaatccattgtgttgtgtgaactgtttgcaaaagtgagtatttgtgtgattttctttagctttacaactaatttgt |
7643833 |
T |
|
| Q |
121 |
tggtccctcaaa |
132 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7643832 |
tggtccctcaaa |
7643821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 268 - 369
Target Start/End: Complemental strand, 7643685 - 7643584
Alignment:
| Q |
268 |
tgtaatacaattgcctataaattaaagtcgctaaaaacaaaaggcataaatatgtaaacaaactttgtcgtcggatctagttttatgagctcatgtggtt |
367 |
Q |
| |
|
||||||| || |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7643685 |
tgtaatagaactgcctacaaattaaagtcgctaaaaacaaaaagcataaatatgtaaacaaactttgtcgtcggatctagttttatgagctcatgtggtt |
7643586 |
T |
|
| Q |
368 |
tc |
369 |
Q |
| |
|
|| |
|
|
| T |
7643585 |
tc |
7643584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 7643745 - 7643705
Alignment:
| Q |
208 |
gagataacgcttattaagccatactaaatatgtcatgttat |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7643745 |
gagataacacttattaagccatactaaatatgtcatgttat |
7643705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University